90
|
Inqaba biotec
reverse primer 5’-ggtggcgatcttgaacttctt-3 Reverse Primer 5’ Ggtggcgatcttgaacttctt 3, supplied by Inqaba biotec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer 5’-ggtggcgatcttgaacttctt-3/product/Inqaba biotec Average 90 stars, based on 1 article reviews
reverse primer 5’-ggtggcgatcttgaacttctt-3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GATC Biotech
forward primer 5’- ttaactccctgcaagcctca -3 Forward Primer 5’ Ttaactccctgcaagcctca 3, supplied by GATC Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 5’- ttaactccctgcaagcctca -3/product/GATC Biotech Average 90 stars, based on 1 article reviews
forward primer 5’- ttaactccctgcaagcctca -3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
First BASE Laboratories
reverse primer 5′-aaggaggtgatccagccgca-3′ Reverse Primer 5′ Aaggaggtgatccagccgca 3′, supplied by First BASE Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse primer 5′-aaggaggtgatccagccgca-3′/product/First BASE Laboratories Average 90 stars, based on 1 article reviews
reverse primer 5′-aaggaggtgatccagccgca-3′ - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Sigma-Genosys
forward primer 5′-tac cgg gcg gtg acg gag tg-3′ Forward Primer 5′ Tac Cgg Gcg Gtg Acg Gag Tg 3′, supplied by Sigma-Genosys, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 5′-tac cgg gcg gtg acg gag tg-3′/product/Sigma-Genosys Average 90 stars, based on 1 article reviews
forward primer 5′-tac cgg gcg gtg acg gag tg-3′ - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
forward-primer 5’-ccctgaatgcggctaatcc-3 Forward Primer 5’ Ccctgaatgcggctaatcc 3, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward-primer 5’-ccctgaatgcggctaatcc-3/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
forward-primer 5’-ccctgaatgcggctaatcc-3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
NCIMB Ltd
forward primer 5«-gccggaggtcattgctagtggagtc-3 Forward Primer 5« Gccggaggtcattgctagtggagtc 3, supplied by NCIMB Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 5«-gccggaggtcattgctagtggagtc-3/product/NCIMB Ltd Average 90 stars, based on 1 article reviews
forward primer 5«-gccggaggtcattgctagtggagtc-3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
5 PRIME
generacertm nested 3 prime primer Generacertm Nested 3 Prime Primer, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/generacertm nested 3 prime primer/product/5 PRIME Average 90 stars, based on 1 article reviews
generacertm nested 3 prime primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Promega
5′-tcc gct act ggc atc ggt-3′ seq id no:9 5′ Tcc Gct Act Ggc Atc Ggt 3′ Seq Id No:9, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/5′-tcc gct act ggc atc ggt-3′ seq id no:9/product/Promega Average 90 stars, based on 1 article reviews
5′-tcc gct act ggc atc ggt-3′ seq id no:9 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
Operon Technologies Inc
primer 5'-cca caggaattcctgcagta ctagc -3 Primer 5' Cca Caggaattcctgcagta Ctagc 3, supplied by Operon Technologies Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5'-cca caggaattcctgcagta ctagc -3/product/Operon Technologies Inc Average 90 stars, based on 1 article reviews
primer 5'-cca caggaattcctgcagta ctagc -3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
5 PRIME
515f primer 515f Primer, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/515f primer/product/5 PRIME Average 90 stars, based on 1 article reviews
515f primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
GeNOsys Inc
primer 5’ tcagtagacggtgaccgaggttccttgaccccagta3 Primer 5’ Tcagtagacggtgaccgaggttccttgaccccagta3, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5’ tcagtagacggtgaccgaggttccttgaccccagta3/product/GeNOsys Inc Average 90 stars, based on 1 article reviews
primer 5’ tcagtagacggtgaccgaggttccttgaccccagta3 - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
90
|
TIB MOLBIOL
drd2/ankk1 taq ia (rs1800497) reverse primer Drd2/Ankk1 Taq Ia (Rs1800497) Reverse Primer, supplied by TIB MOLBIOL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/drd2/ankk1 taq ia (rs1800497) reverse primer/product/TIB MOLBIOL Average 90 stars, based on 1 article reviews
drd2/ankk1 taq ia (rs1800497) reverse primer - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |