90
|
Midland Certified Reagent
20-mer primer (5′-acagtccctgttcgggcgcc-3′) bearing a cross-linkable thioalkyl tether (on g in the primer strand) 20 Mer Primer (5′ Acagtccctgttcgggcgcc 3′) Bearing A Cross Linkable Thioalkyl Tether (On G In The Primer Strand), supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/20-mer primer (5′-acagtccctgttcgggcgcc-3′) bearing a cross-linkable thioalkyl tether (on g in the primer strand)/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
20-mer primer (5′-acagtccctgttcgggcgcc-3′) bearing a cross-linkable thioalkyl tether (on g in the primer strand) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Premier Biosoft
primer 5.0 software Primer 5.0 Software, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5.0 software/product/Premier Biosoft Average 90 stars, based on 1 article reviews
primer 5.0 software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Premier Biosoft
premier primer 5.0 Premier Primer 5.0, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/premier primer 5.0/product/Premier Biosoft Average 90 stars, based on 1 article reviews
premier primer 5.0 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
primers designed with p3 primer design online software Primers Designed With P3 Primer Design Online Software, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers designed with p3 primer design online software/product/PrimerDesign Inc Average 90 stars, based on 1 article reviews
primers designed with p3 primer design online software - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
STAB VIDA
gdnf forward primer-5’ gacttgggtttgggctacgaa 3’ Gdnf Forward Primer 5’ Gacttgggtttgggctacgaa 3’, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gdnf forward primer-5’ gacttgggtttgggctacgaa 3’/product/STAB VIDA Average 90 stars, based on 1 article reviews
gdnf forward primer-5’ gacttgggtttgggctacgaa 3’ - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
PRIMER-E
primer 5.0 Primer 5.0, supplied by PRIMER-E, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5.0/product/PRIMER-E Average 90 stars, based on 1 article reviews
primer 5.0 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GeNOsys Inc
forward primer 5 -tgttttgg gacgatgttcca-3 Forward Primer 5 Tgttttgg Gacgatgttcca 3, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer 5 -tgttttgg gacgatgttcca-3/product/GeNOsys Inc Average 90 stars, based on 1 article reviews
forward primer 5 -tgttttgg gacgatgttcca-3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
MWG-Biotech ag
il-6 reverse primer (5¢-tgagggtggggccagagc-3¢) Il 6 Reverse Primer (5¢ Tgagggtggggccagagc 3¢), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il-6 reverse primer (5¢-tgagggtggggccagagc-3¢)/product/MWG-Biotech ag Average 90 stars, based on 1 article reviews
il-6 reverse primer (5¢-tgagggtggggccagagc-3¢) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Fisher Scientific
0.8 m external c 1 antisense primer (5 -gctgctcagagtgtagaggtc-3 ) 0.8 M External C 1 Antisense Primer (5 Gctgctcagagtgtagaggtc 3 ), supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/0.8 m external c 1 antisense primer (5 -gctgctcagagtgtagaggtc-3 )/product/Fisher Scientific Average 90 stars, based on 1 article reviews
0.8 m external c 1 antisense primer (5 -gctgctcagagtgtagaggtc-3 ) - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pyrosequencing Inc
primer 5'-ggtctacccttggacc3 Primer 5' Ggtctacccttggacc3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5'-ggtctacccttggacc3/product/Pyrosequencing Inc Average 90 stars, based on 1 article reviews
primer 5'-ggtctacccttggacc3 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Operon Biotech
downstream primer 5′-ttatgaggatctctct gatttttcttgcgt-3′ Downstream Primer 5′ Ttatgaggatctctct Gatttttcttgcgt 3′, supplied by Operon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/downstream primer 5′-ttatgaggatctctct gatttttcttgcgt-3′/product/Operon Biotech Average 90 stars, based on 1 article reviews
downstream primer 5′-ttatgaggatctctct gatttttcttgcgt-3′ - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Premier Biosoft
primer 5.0 Primer 5.0, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer 5.0/product/Premier Biosoft Average 90 stars, based on 1 article reviews
primer 5.0 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |