primer 5 Search Results


90
Midland Certified Reagent 20-mer primer (5′-acagtccctgttcgggcgcc-3′) bearing a cross-linkable thioalkyl tether (on g in the primer strand)
20 Mer Primer (5′ Acagtccctgttcgggcgcc 3′) Bearing A Cross Linkable Thioalkyl Tether (On G In The Primer Strand), supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/20-mer primer (5′-acagtccctgttcgggcgcc-3′) bearing a cross-linkable thioalkyl tether (on g in the primer strand)/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
20-mer primer (5′-acagtccctgttcgggcgcc-3′) bearing a cross-linkable thioalkyl tether (on g in the primer strand) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Premier Biosoft primer 5.0 software
Primer 5.0 Software, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5.0 software/product/Premier Biosoft
Average 90 stars, based on 1 article reviews
primer 5.0 software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Premier Biosoft premier primer 5.0
Premier Primer 5.0, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/premier primer 5.0/product/Premier Biosoft
Average 90 stars, based on 1 article reviews
premier primer 5.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc primers designed with p3 primer design online software
Primers Designed With P3 Primer Design Online Software, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers designed with p3 primer design online software/product/PrimerDesign Inc
Average 90 stars, based on 1 article reviews
primers designed with p3 primer design online software - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
STAB VIDA gdnf forward primer-5’ gacttgggtttgggctacgaa 3’
Gdnf Forward Primer 5’ Gacttgggtttgggctacgaa 3’, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gdnf forward primer-5’ gacttgggtttgggctacgaa 3’/product/STAB VIDA
Average 90 stars, based on 1 article reviews
gdnf forward primer-5’ gacttgggtttgggctacgaa 3’ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
PRIMER-E primer 5.0
Primer 5.0, supplied by PRIMER-E, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5.0/product/PRIMER-E
Average 90 stars, based on 1 article reviews
primer 5.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GeNOsys Inc forward primer 5 -tgttttgg gacgatgttcca-3
Forward Primer 5 Tgttttgg Gacgatgttcca 3, supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer 5 -tgttttgg gacgatgttcca-3/product/GeNOsys Inc
Average 90 stars, based on 1 article reviews
forward primer 5 -tgttttgg gacgatgttcca-3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
MWG-Biotech ag il-6 reverse primer (5¢-tgagggtggggccagagc-3¢)
Il 6 Reverse Primer (5¢ Tgagggtggggccagagc 3¢), supplied by MWG-Biotech ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il-6 reverse primer (5¢-tgagggtggggccagagc-3¢)/product/MWG-Biotech ag
Average 90 stars, based on 1 article reviews
il-6 reverse primer (5¢-tgagggtggggccagagc-3¢) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Fisher Scientific 0.8 m external c 1 antisense primer (5 -gctgctcagagtgtagaggtc-3 )
0.8 M External C 1 Antisense Primer (5 Gctgctcagagtgtagaggtc 3 ), supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/0.8 m external c 1 antisense primer (5 -gctgctcagagtgtagaggtc-3 )/product/Fisher Scientific
Average 90 stars, based on 1 article reviews
0.8 m external c 1 antisense primer (5 -gctgctcagagtgtagaggtc-3 ) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pyrosequencing Inc primer 5'-ggtctacccttggacc3
Primer 5' Ggtctacccttggacc3, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5'-ggtctacccttggacc3/product/Pyrosequencing Inc
Average 90 stars, based on 1 article reviews
primer 5'-ggtctacccttggacc3 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Operon Biotech downstream primer 5′-ttatgaggatctctct gatttttcttgcgt-3′
Downstream Primer 5′ Ttatgaggatctctct Gatttttcttgcgt 3′, supplied by Operon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/downstream primer 5′-ttatgaggatctctct gatttttcttgcgt-3′/product/Operon Biotech
Average 90 stars, based on 1 article reviews
downstream primer 5′-ttatgaggatctctct gatttttcttgcgt-3′ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Premier Biosoft primer 5.0
Primer 5.0, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer 5.0/product/Premier Biosoft
Average 90 stars, based on 1 article reviews
primer 5.0 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results